Campus Units

Animal Science

Document Type

Article

Publication Version

Published Version

Publication Date

1997

Journal or Book Title

Journal of Animal Science

Volume

75

Issue

8

First Page

2286

Last Page

2286

DOI

/1997.7582286x

Abstract

Source and Description of Primers. We previously identified a SacI polymorphism by using a pig VCAM1 cDNA probe on Southern blots (VCAM1-1; Helm et al., 1994). This polymorphism was not informative enough to map VCAM1. To develop PCR-based genotyping, we sequenced the 3¢ untranslated region of pig VCAM1. Subsequently, a pig VCAM1 cDNA was deposited in Genbank; our data agree completely with that reported by Tsang et al. (Accession: U08351). The PCR primers were designed (forward, 5¢-TATCAGCCCTCCATAGTCACAT 3¢ and reverse, 5¢- GAAATTGTTGTCCATGACCTTTAT 3¢) .

Comments

This is an article from Journal of Animal Science 75 (1997): 2286, doi:/1997.7582286x. Posted with permission.

Copyright Owner

American Society of Animal Science

Language

en

File Format

application/pdf

Share

COinS